![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 16:30
As , plants meet their needs for making food from air, soil, water, and the sun's energy in a process called there are plants called grow high in trees without here are words to put in the blanks. 1.) producers 2.) consumers 3.) chloroplasts 4.) epiphytes
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:30
As global warming continues the ocean absorbs more of the earth's heat what term describes the ocean as a storage location for heat a) heat binb) heat sinkc) heat storaged) heat vent( answer this for me)
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:50
What is it called when part of a cell membrane closes around a molecule to allow the molecule to enter the cell? a. passive transport b.diffusion c. endocytosis d. exocytosisc. endocytosis
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
1st attempt A segmented viral genome Choose one: A. is packaged at random into new virion particles....
Questions
![question](/tpl/images/cats/en.png)
English, 06.01.2021 19:40
![question](/tpl/images/cats/mat.png)
Mathematics, 06.01.2021 19:40
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.01.2021 19:40
![question](/tpl/images/cats/mat.png)
Mathematics, 06.01.2021 19:40
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.01.2021 19:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/fizika.png)
Physics, 06.01.2021 19:40
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 06.01.2021 19:40
![question](/tpl/images/cats/mat.png)
Mathematics, 06.01.2021 19:40
![question](/tpl/images/cats/en.png)
English, 06.01.2021 19:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.01.2021 19:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
English, 06.01.2021 19:40
![question](/tpl/images/cats/istoriya.png)
History, 06.01.2021 19:40