A single gene mutation in cats can result in curly ears (see image). The cats are healthy and normal beyond the ear structure, which actually changes after birth.

This trait is recessive, and the allele for curly ears is $ and the allele for regular ears is S.

Which of the following responses are true? (SELECT ALL correct answers)
curly_ear_cat. jpeg

a. A cross between this cat and another curly ear cat will result in 100% curly ears
b. A cross between this cat and another curly ear cat will result in 50% straight ears
c. The genotype of the cat in the picture is $$
d. The phenotype of the cat is $$
e. Mutations are always bad, even in cats.
f. A cross between this cat and another curly ear cat will result in 100% straight ears
g. The genotype of the cat in the picture is S$
h. A cross between this cat and a homozygous normal ear cat will result in 100% normal ears

Which of these is a provisioning service people get from the ocean

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Plz ! what does it mean for an allele to be dominant?