Biology, 14.02.2020 20:41 CoolRahim9090
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.
ATGTCTCTCACCAACAAGAACGTC
ATGgCTCTCACCAACAAGAACGTC
ATGTCgCTCACCAACAAGAACGTC
ATGTCTtTgACCAACAAGAACGTC
a. What are the first eight amino acids for each of these four DNA sequences?
b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.
c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?
Answers: 1
Another question on Biology
Biology, 21.06.2019 22:00
Which is the correct first step in finding the area of the base of a cylinder with a volume of 26x cubic meters and a height of 6.5 meters? v=bh 6.5=b(26x) v=bh v=26pi+(6.5) v=bh v=26pi(6.5) v=bh 26pi=b(6.5)
Answers: 1
Biology, 21.06.2019 22:00
Where would you expect to see seedless plants, such as ferns and mosses? a. in a botanical museum, because they are all extinct b. low and close to the ground in a moist environment c. climbing high while circling the branches of another plant d. deeply rooted in a forest with a trunk that reaches 20 meters or more
Answers: 1
Biology, 22.06.2019 01:00
How are mutations continually being generated in a population (what are some of the causes of mutatuions? ) explain
Answers: 1
Biology, 22.06.2019 09:00
To determine if a particular plant is homozygous or heterozygous, you would have to test cross with a
Answers: 1
You know the right answer?
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh prot...
Questions
Mathematics, 29.05.2020 19:00
English, 29.05.2020 19:00
Geography, 29.05.2020 19:00
Mathematics, 29.05.2020 19:00
Mathematics, 29.05.2020 19:00
