subject
Biology, 11.02.2020 17:58 QueenNerdy889

Under most biological conditions, however, histidine is considered to be a triprotic acid. This is due to the pKa of the being .A. nitrogen in the imidazole ring possessing a hydrogen but no charge; much lower than the pH values normally found in a cellB. nitrogen in the imidazole ring possessing a hydrogen but no charge; much higher than the pH values normally found in a cellC. carboxylic acid; much lower than the pH values normally found in a cellD. carboxylic acid; much higher than the pH values normally found in a cell

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 09:20
Organize the word parts according to where they appear in a medical term.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:50
The law of states that traits are passed from parents to offspring independently of one another.. true or false
Answers: 1
question
Biology, 22.06.2019 14:50
Read this summary of a scientific theory: "cells are the most basic structural and functional units of life. all living organisms are made up of one or more cells. all cells that are alive in the world today came from pre-existing cells." which of the following would require this theory to be modified? -a.) a survey finds that a majority of people believe viruses carry out the basic processes of life. -b.) a prominent scientist says she feels strongly that one day the theory will be challenged by life on other planets. -c.) the dna of unicellular and multi-cellular organisms is shown to have many fundamental similarities. -d.) scientific observations show that microscopic organisms living in the deep ocean are not made up of cells.
Answers: 1
You know the right answer?
Under most biological conditions, however, histidine is considered to be a triprotic acid. This is d...
Questions
Questions on the website: 13722359