Biology, 10.02.2020 02:05 ykpwincess
PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Be sure to answer this question in paragraph form using complete sentences.
Answers: 1
Biology, 22.06.2019 01:30
Select the correct answer. which term do biologists use to describe the average number of individuals of a species per unit area? a. carrying capacity b. population density c. minimal viable population d. survivability curve
Answers: 1
Biology, 22.06.2019 02:30
The idea that all living things are made up of cells is considered scientific law. this means the idea is an emerging scientific idea that has a logical explanation. has been tested with similar results at least twice. is supported by scientific consensus and a large amount of evidence. has been rejected only once by the scientific community
Answers: 1
Biology, 22.06.2019 16:30
Which part of the spine is likely to cause a nerve signal to travel faster? a. backbones b. white matter c. nuclei d. gray matter
Answers: 2
Biology, 22.06.2019 19:50
Select the correct answer from each drop-down menu the images show fossils of a modern bird and two extinct organisms (a tyrannosaurus rex and an archaeopteryx). based on the structure of the three organisms, it can be concluded that the archaeopteryx and bird have wings, while dinosaurs have limhe se it can be concluded that
Answers: 3
PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation i...
A certain segment of DNA can be used as a molecular clock. Its rate of mutation i...
Geography, 16.10.2020 04:01
Mathematics, 16.10.2020 04:01
Business, 16.10.2020 04:01
Mathematics, 16.10.2020 04:01
Mathematics, 16.10.2020 04:01
Mathematics, 16.10.2020 04:01
History, 16.10.2020 04:01
Geography, 16.10.2020 04:01
Health, 16.10.2020 04:01
Mathematics, 16.10.2020 04:01
History, 16.10.2020 04:01