subject
Biology, 18.01.2020 00:31 pearfam98

It is difficult to imagine how only part of an adaptation could function, but darwin explained this. how would he answer the question, “what good is 5% of an eye? ”

a) once an organism has the first 5% of an adaptation, the rest will quickly evolve.
b) five percent of an eye is always better than a full eye since it is easier to grow. the difficulty is in explaining fully formed eyes.
c) since variation is random, we don’t expect to see more than about 5% of an eye in any species.
d) five percent of an eye, perhaps a simple light-sensitive spot, is often better than having no eye at all.

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 07:30
The hematodinium parasite becomes less of a problem for the blue crab when the crab is very young. fishing is thriving in the region. the crab moves to less salty water. a significant percentage of the population is impacted.
Answers: 3
question
Biology, 22.06.2019 09:00
Select all that apply genes are specific nucleotide sequences occur in numbers that are the same as the number of chromosomes are located in a specific place on a chromosome determine the traits of an organism are units of rna
Answers: 1
question
Biology, 22.06.2019 10:00
The image shows the evolution of a species of fish. a few fish from a population developed different social behaviors and evolved into different species. two fish according to the image, the fish underwent . the new species of fish had mating seasons that were different from that of the original fish. because of the differences in mating seasons, the fish underwent reproductive isolation. this mode of isolation would be .
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
It is difficult to imagine how only part of an adaptation could function, but darwin explained this....
Questions
question
Mathematics, 14.07.2020 01:01
question
Mathematics, 14.07.2020 01:01
question
Mathematics, 14.07.2020 01:01
question
Mathematics, 14.07.2020 01:01
question
Mathematics, 14.07.2020 01:01
question
Spanish, 14.07.2020 01:01
Questions on the website: 13722360