During dna replication, the dna molecule combines into two strands. select the best answer from the choices provided
a. true
b. false

Answers to mastering biology drag the labels to their appropriate locations to complete the punnett squares for morgan's reciprocal cross. drag blue labels onto the blue targets to indicate the genotypes of the parents and offspring. drag pink labels onto the pink targets to indicate the genetic makeup of the gametes (sperm and egg). labels can be used once, more than once, or not at all. hints

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

The more rapidly sedimentation occurs, the more likely it is that the remains will successfully form a fossil. as sedimentation continues, what happens to the amount of weight settling onto the organism? stays the same increases decreases cuts in half