There have been several mass extinctions in the planet's history, such as the extinction of the dinosaurs, but the current mass extinction is different. greater numbers of species are now going extinct faster than ever before. also unique to the current mass extinction is the cause.
what is causing the current mass extinction?
rising sea levelsclimate changesolar flaresman's direct activities

Food webs - transferring energy and matter from one level to another. here you see four food webs. one or more are incorrect. which food web(s) show the correct sequence of organisms, from start to top level consumer? a) a b) d c) c d) a and d

Consider the venn diagram of plant reproduction. where in this image, areas a - d, would you insert the picture of the orange lily?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?