![subject](/tpl/images/cats/biologiya.png)
Biology, 02.12.2019 06:31 meganpaughstu
Osmosis, or the movement of water into and out of a cell, is directly related to the concentration gradient on both sides of the cell membrane and indirectly to the fact that
a) water has a high heat of vaporization.
b) water has hydrogen bonds that promote cohesion.
c) the adhesive properties of water promote its capillarity.
d) the polarity of water molecules make it the universal solvent
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:30
If assuming tasting ptc as a simple gene trait,what other genotype would you select to put in this missing genotype box that could result in this phenotype
Answers: 3
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:30
Which genetic disorders, caused by an extra x chromosome (xxy), is characterized by a lack of testicular development in males, effeminate features, possible mental impairment, and a thin stature?
Answers: 1
You know the right answer?
Osmosis, or the movement of water into and out of a cell, is directly related to the concentration g...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 08.10.2019 03:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 08.10.2019 03:30
![question](/tpl/images/cats/en.png)
English, 08.10.2019 03:30
![question](/tpl/images/cats/mat.png)
Mathematics, 08.10.2019 03:30
![question](/tpl/images/cats/mat.png)
Mathematics, 08.10.2019 03:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 08.10.2019 03:30
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
History, 08.10.2019 03:30
![question](/tpl/images/cats/biologiya.png)
Biology, 08.10.2019 03:30
![question](/tpl/images/cats/mat.png)
Mathematics, 08.10.2019 03:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 08.10.2019 03:30