subject
Biology, 30.11.2019 18:31 janeou17xn

The chamber of mammalian heart with the thickest wall is the?

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 08:20
Which is not a characteristic of bacteria? a. they are unicellular. b. they are prokaryotic. c. they are the smallest form of life on earth. d. they are multicellular.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
Select the word from the list that best fits the definition the temperature to which air must cool to be saturated
Answers: 3
question
Biology, 22.06.2019 13:00
Dna, in the nucleus carries the genetic code for making proteins in ribosomes. in the diagram, b, represents the proteins produced. dna cannot leave the nucleus to carry the genetic information to the ribosome where proteins are produced. how does the genetic code get from the nucleus to the ribosome? what does a represent? now
Answers: 1
You know the right answer?
The chamber of mammalian heart with the thickest wall is the?...
Questions
question
Physics, 18.03.2021 01:20
question
Mathematics, 18.03.2021 01:20
question
English, 18.03.2021 01:20
question
Mathematics, 18.03.2021 01:20
question
Mathematics, 18.03.2021 01:20
question
Mathematics, 18.03.2021 01:20
question
Social Studies, 18.03.2021 01:20
Questions on the website: 13722363