You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-generated trace of the intensity of each color's fluorescence). in this figure, a = green, c = purple, g = black, t = red. the height of the peaks is unimportant. the 5' end of the sequence is at the left of the trace.

what is the sequence of the template dna used for this sequencing reaction?

a.

5' tttgctttgtgagcggataacaa 3'

b.

3' tttgctttgtgagcggataacaa 5'

c.

5' aaacgaaacactcgcctattgtt 3'

d.

5’ ttgttatccgctcacaaagcaaa 3’

e.

3' aaacgaaacactcgcctattgtt 5'

can someone with this? i can never get more than 3/5 right:

match the following terms with their descriptions below.

question selected match
used to detect close or exact complementarity to a probe sequence

c.
high stringency

used in identifying a specific mrna from a mixture

a.
northern blot

used to quantitate the initial template concentration of an unknown relative to a standard template of known concentration

b.
template dna

reliant upon dna mismatch repair

d.
site-directed mutagenesis

refers to the sequence of interest within the sample in a pcr reaction

e.
cycle threshold method (ct)

4

a fossil fuel is a fuel formed by natural processes, such as anaerobic decomposition of buried dead organisms, containing energy originating in ancient photosynthesis.[1] the age of the organisms and their resulting fossil fuels is typically millions of years, and sometimes exceeds 650 million years.[2] fossil fuels contain high percentages of carbon and include petroleum, coal, and natural gas.[3] other commonly used derivatives include kerosene and propane. fossil fuels range from volatile materials with low carbon to hydrogen ratios like methane, to liquids like petroleum, to nonvolatile materials composed of almost pure carbon, like anthracite coal. methane can be found in hydrocarbon fields either alone, associated with oil, or in the form of methane clathrates.

the theory that fossil fuels formed from the fossilized remains of dead plants by exposure to heat and pressure in the earth's crust over millions of years was first introduced by andreas libavius "in his 1597 alchemia [alchymia]" and later by mikhail lomonosov "as early as 1757 and certainly by 1763".[4] the first use of the term "fossil fuel" was by the german chemist caspar neumann, in english translation in 1759.[5]

in 2017 the world's primary energy sources consisted of petroleum (34%), coal (28%), natural gas (23%), amounting to an 85% share for fossil fuels in primary energy consumption in the world.[6] non-fossil sources in 2006 included nuclear (8.5%), hydroelectric (6.3%), and others (geothermal, solar, tidal, wind, wood, waste) amounting to 0.9%.[7] world energy consumption was growing at about 2.3% per year. in 2015 about 18% of worldwide consumption was from renewable sources.[8]