Biology, 23.11.2019 04:31 cxttiemsp021
The protostome developmental sequence arose just once in evolutionary history. true or false
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:40
As an asteroid comes close to earth, it's name will change to? apex
Answers: 1
Biology, 22.06.2019 19:00
If garbage is left on the street flies in microbes can arise from nothing to feed on it true or false
Answers: 1
Biology, 22.06.2019 20:20
How is anaerobic respiration affected by changes in temperature? (5 points)based on the conditions of early earth, what conclusion can you draw about the amount of anaerobic respiration that was occurring at earth’s beginning? explain your answer.(5 points)if there was a sudden drop in temperature after the evolution of the first living cells, predict how that might have affected the changes in the atmosphere and the evolution of cyanobacteria and other autotrophs. explain your answer. (5 points)
Answers: 1
The protostome developmental sequence arose just once in evolutionary history. true or false...
Biology, 04.12.2020 15:40
Mathematics, 04.12.2020 15:40
History, 04.12.2020 15:40
History, 04.12.2020 15:50
History, 04.12.2020 15:50
Mathematics, 04.12.2020 15:50
Mathematics, 04.12.2020 15:50
Mathematics, 04.12.2020 15:50
Mathematics, 04.12.2020 15:50
Mathematics, 04.12.2020 15:50
English, 04.12.2020 15:50