subject
Biology, 20.11.2019 23:31 fluffpupkiki

What are the parts or processes that can describe an ecosystem?
o a) chemical changes
ob) flow of energies
c) both chemical changes and flow of energies
od) neither chemical changes or flow of energies

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 03:50
The breakdown of food is accomplished by enzymes. a. physical b. chemical c. mechanical d. none of the above
Answers: 1
question
Biology, 22.06.2019 10:00
Dna and rna share a number of similarities,but they also differ in certain aspects of their structure. wich nitrogenous base is found in rna but is not found in dna
Answers: 1
question
Biology, 22.06.2019 10:40
Describe characteristics of a good respitory surface
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What are the parts or processes that can describe an ecosystem?
o a) chemical changes
o...
Questions
Questions on the website: 13722363