subject
Biology, 13.11.2019 07:31 porfi

Asingle species of fish, the three-spined spinyback, once inhabited a large lake. at some point in the lake's history, lava flowed from a nearby volcano into the lake cutting it into three completely isolated mini-lakes. despite the heat from the lava, a few individuals from the original population of spinyback survive in each mini-lake. three million years later, a researcher finds that each mini-lake is inhabited by its own species of spinyback. which of the following figures most closely reflects how the three species of spiny back are related to one another? a. tree h b. tree k c. tree m e. tree l

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 10:00
Dna and rna share a number of similarities,but they also differ in certain aspects of their structure. wich nitrogenous base is found in rna but is not found in dna
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
This is a scaffolding of protein fibers that us sell keep it shape in a cell division and cell movement
Answers: 1
question
Biology, 22.06.2019 14:30
The human body needs energy in order to carry out life processes such as breathing. where does the body get this energy? a. from eating food b. from learning about new things c. from lying in the sun d. from sleeping
Answers: 1
You know the right answer?
Asingle species of fish, the three-spined spinyback, once inhabited a large lake. at some point in t...
Questions
question
Mathematics, 18.04.2020 23:17
question
Mathematics, 18.04.2020 23:17
question
Mathematics, 18.04.2020 23:17
question
Mathematics, 18.04.2020 23:17
question
Health, 18.04.2020 23:17
question
Mathematics, 18.04.2020 23:17
question
Mathematics, 18.04.2020 23:18
question
Biology, 18.04.2020 23:18
question
Mathematics, 18.04.2020 23:18
Questions on the website: 13722363