Biology, 07.11.2019 04:31 patrickdolano
Which base are present in the dna of the plant? the mammal? the bacterium? are the same bases present in all three cases? are the bases in the same order?
Answers: 1
Biology, 22.06.2019 04:50
Describe the function of the endomembrane system? what organelles are involved?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30
In meiosis ii during anaphase ii which structures separated homologous chromosomes or sister chromatids
Answers: 1
Biology, 22.06.2019 14:50
Lactase is essential for digesting lactose in milk. this enzyme is specific for this sugar. why? molecules and active sites vary in size; only properly sized molecules can fit.there is a precise compatibility between the active site and the lactose molecule.specificity refers to the action of the enzyme, such as hydrolysis, and relatively few molecules can be hydrolyzed.reaction-specific enzymes assume a fit by folding around the most numerous substrate molecules.
Answers: 1
Which base are present in the dna of the plant? the mammal? the bacterium? are the same bases pre...
Social Studies, 14.01.2020 20:31
Chemistry, 14.01.2020 20:31
Computers and Technology, 14.01.2020 20:31
English, 14.01.2020 20:31
Physics, 14.01.2020 20:31
English, 14.01.2020 20:31
Social Studies, 14.01.2020 20:31
Mathematics, 14.01.2020 20:31