subject
Biology, 08.10.2019 03:10 treymartinez7250

What makes the seaweed different from all the other plants?

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 19:30
Which of the following is one of the four conditions necessary for natural selection to occur in a population? fewer organisms are born than the habitat can support mutation does not occur organisms have identical characteristics variation is inherited
Answers: 1
question
Biology, 22.06.2019 07:30
Gregor mendel is best known for his work with pea plants and for uncover many of the mysteries of genetics. one of his major findings stated that there were specific, physical units of inheritance that are transmitted during reproduction. what is the the name given to these units of inheritance which can be found on chromosomes? a) centromeres b) cytoplasm c) genes d) nucleotides
Answers: 1
question
Biology, 22.06.2019 10:30
Which of the following graphs have the same wavelengths
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What makes the seaweed different from all the other plants?...
Questions
question
Mathematics, 01.08.2020 19:01
Questions on the website: 13722367