subject
Biology, 31.08.2019 02:10 Shadow0202

The contractile unit in the muscle cell is called the
a. z-line
b. myofilament
c. sarcomere
d. myosin

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 00:30
Ais a landform that is formed at the mouth of a river from the deposition of sediment carried by the river as the water flows.
Answers: 2
question
Biology, 22.06.2019 02:50
Factors that can increase mutation rates a. high temps b. low temps c. food additives d. uv rays
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
What are the pros and cons of transect sampling?
Answers: 1
You know the right answer?
The contractile unit in the muscle cell is called the
a. z-line
b. myofilament
c....
Questions
question
Mathematics, 21.08.2019 22:50
question
Mathematics, 21.08.2019 22:50
question
English, 21.08.2019 22:50
question
Mathematics, 21.08.2019 22:50
Questions on the website: 13722360