Biology, 17.07.2019 17:10 student0724
Most of the year, the hermit thrush, a north american songbird, eats a diet consisting mainly of insects, but in autumn, as the thrushes migrate to their central and south american wintering grounds, they feed almost exclusively on wild berries. wild berries, however, are not as rich in calories as insects, yet thrushes need to consume plenty of calories in order to complete their migration. one possible explanation is that berries contain other nutrients that thrushes need for migration and that insects lack. which of the following, if true, most seriously calls into question the explanation given for the thrush's diet during migration?
(a) hermit thrushes, if understood, are unable to complete their autumn migration before the onset of winter
(b) insect species contain certain nutrients that are not found in wild berries
(c) for songbirds, catching insects requires the expenditure of significantly more calories than eating wild berries
(d) along the hermit thrushes" migration routes, insects are abundantthoughout the migration season
(e) there are some species of wild berries that hermit thrushes generally do not eat, even though these berry species are exceptionally rich in calories.
Answers: 1
Biology, 22.06.2019 00:00
As a small change in a person's dna can cause a genetic disorder
Answers: 1
Biology, 22.06.2019 03:10
Clues to ecological principles are given in numerous passages of the bible. a bible study of ecology actually opens the doors to better understanding of god's love and concern for the earth. use a concordance to locate bible passages associated with words concerning our stewardship of the earth. you may use a dictionary to find synonyms for these words: dominion replenish subdue judgment stewardship find each of the passages using these words related to principles of ecology. list all passages by quote, book, chapter, and verse under each word. use your own interpretation to rewrite what you think each verse is saying. after your discussion of each of these words, ask one other person to explain his understanding of the word and a related verse without any hints. summarize what he tells you. a concluding paragraph for each of the words should be written noting similarities and differences between your interpretation and that of each person consulted.
Answers: 1
Biology, 22.06.2019 09:50
The frequency of alleles in a population that is in hardy weinberg equilibrium? a . changes in each successive generation b. is less important than the frequency genotypes c. shows evidence of the process of natural selection d. remains the same over several generations
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Most of the year, the hermit thrush, a north american songbird, eats a diet consisting mainly of ins...
Mathematics, 29.11.2019 09:31
Social Studies, 29.11.2019 09:31
Computers and Technology, 29.11.2019 09:31
English, 29.11.2019 09:31
Spanish, 29.11.2019 09:31
Mathematics, 29.11.2019 09:31
Biology, 29.11.2019 09:31
Mathematics, 29.11.2019 09:31
Social Studies, 29.11.2019 09:31
Biology, 29.11.2019 09:31