Biology, 19.10.2019 05:30 jaquiel9358

Choose all the answers that apply.

invasive species:

a) can increase competition
b) prevent extinction
c) reduce disease in a population
d) are not native to the environment

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 15:30

Sammi is studying the interaction of the digestive and circulatory systems in the human body. she has listed various processes that occur in each of the systems. put the processes in order to describe the interaction between these two systems. tiles nutrients diffuse through the villi of the small intestine.digestive processes break nutrients down in the mouth, stomach, and small intestine.blood is pumped through the circulatory system to deliver nutrients to other organs.nutrients are ingested at the mouth.nutrients enter the capillaries of the circulatory system. sequence

Answers: 2

Answer

Biology, 22.06.2019 07:00

Time remaini 02: 50: 5 in the farewell speech, queen elizabeth's use of first-person point of view her to appear to be impartial and objective prevents her from addressing the audience directly allows her to share her personal thoughts and ideas, makes it seem as though she's observing from the outside, mack this and return save and evit

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

Biology, 22.06.2019 14:30

The process of meiosis produces only gametes, eggs or sperm. according to the diagram, how many sperm are formed from each cell that undergoes meiosis?

Answers: 1

Answer

You know the right answer?

Choose all the answers that apply.

invasive species:

a) can increase compet...

Questions