subject
Biology, 04.10.2019 19:00 seanisom7

Goodbye
in which type of government are citizens most likely to choose their leader?

question 8 options:

dictatorship

oligarchy

democracy

monarchy

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 05:00
What best describes the dropping height of a ball that bounces back up to a height of 45 cm
Answers: 1
question
Biology, 22.06.2019 10:30
In what cells is the human genome located?
Answers: 1
question
Biology, 22.06.2019 11:00
4. if a cell is placed inside a solution that has a higher concentration of solute than on the inside of the cell, what can be said about the movement of water? a. water will move out of the cell, causing it to shrivel. b. water will move in and out of the cell at the same rate. c. water will move out of the cell, causing it to swell. d. water will move into the cell, causing it to swell.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Goodbye
in which type of government are citizens most likely to choose their leader?
Questions
question
Social Studies, 21.01.2021 03:00
question
Chemistry, 21.01.2021 03:00
Questions on the website: 13722367