Which of the following statements is true?
a) when you add heat to a substance, its temperat...
![subject](/tpl/images/cats/biologiya.png)
Biology, 26.09.2019 16:00 tylorroundy
Which of the following statements is true?
a) when you add heat to a substance, its temperature usually increases.
b) when a substance gives off heat, its temperature increases.
c) heat and temperature are the same.
d) heat is transferred from a substance to the air surrounding it because both have the same temperature.
![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 16:20
The use of dna as evidence in criminal investigations became possible because of the
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00
Brainliest ! which would require more force to move or slow down between a bowling ball and a soccer ball? explain why?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:30
Explain how light energy is turned into chemical energy? ! due tomorrow!
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 14.01.2021 01:40
![question](/tpl/images/cats/mat.png)
Mathematics, 14.01.2021 01:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.01.2021 01:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 14.01.2021 01:40
![question](/tpl/images/cats/fizika.png)
Physics, 14.01.2021 01:40
![question](/tpl/images/cats/mir.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.01.2021 01:40
![question](/tpl/images/cats/mat.png)
Mathematics, 14.01.2021 01:40
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.01.2021 01:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fr.png)
![question](/tpl/images/cats/istoriya.png)
History, 14.01.2021 01:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.01.2021 01:40