subject
Biology, 19.11.2019 07:31 alananicoleee

Which segments are correct concerning human dna

1. it contains 23 chromosomes
2. it contains 46 chromosomes
3. each strand contains chromosomes from one parent
4. each chromosome contains 23 genes

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 04:30
What characteristic make legumes a good food source for food insecure populations
Answers: 3
question
Biology, 22.06.2019 08:30
Answer now! good pts and a brainliest potatoes are what im like a potatoe irdk have a good day
Answers: 2
question
Biology, 22.06.2019 11:00
1. which of the following transport mechanisms utilizes energy? a. osmosis b. diffusion c. facilitated diffusion d. endocytosis
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which segments are correct concerning human dna

1. it contains 23 chromosomes
2. it...
Questions
question
Mathematics, 10.10.2019 05:30
Questions on the website: 13722363