subject
Biology, 11.12.2019 02:31 jsmn7438

Which of the following is true for a cell that has a nucleus
a. it will not have a nuclear membrane.
b. it will not have a nucloelus.
c. it will not have ribosomes.
d. it will not have a nucleoid.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 10:20
What are the ingredients of oobleck?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
Is dna the same in every cell in the human body explain your answer
Answers: 2
question
Biology, 22.06.2019 15:00
Which was not a reason why canals were built in florida
Answers: 1
You know the right answer?
Which of the following is true for a cell that has a nucleus
a. it will not have a nuclear mem...
Questions
question
Mathematics, 04.02.2022 01:10
question
History, 04.02.2022 01:10
question
Social Studies, 04.02.2022 01:20
question
Mathematics, 04.02.2022 01:20
question
Engineering, 04.02.2022 01:20
question
English, 04.02.2022 01:20
question
Physics, 04.02.2022 01:20
Questions on the website: 13722366