Biology, 26.06.2019 21:30 armando87

The information contained within a gene is not directly copied into which of the following chemical forms? a.) mrna, protein b.) mrna, trna c.) trna, protein d.) trna, rrna

Answers: 1

Show answers

Another question on Biology

Biology, 22.06.2019 03:00

20 points and brainlist 1. london has suffered from terrible air pollution for at least seven centuries. why is the city so prone to its famous “london fog? ” what did london do to get rid of its air pollution? 2. why does air pollution cause problems in developing nations more than in developed ones?

Answers: 2

Answer

Biology, 22.06.2019 09:30

What material did the moon come from?

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

Biology, 22.06.2019 17:30

High blood pressure occurs when there is too much blood flowing through the blood vessels at one time. by changing the amount of water in the blood, blood pressure can change. the excretory system can to lower blood pressure.which would most likely occur in the kidney? a)more water would be transferred from the nephron.b)less water would be absorbed into the nephron.c)the amount of water in the bladder would decrease.d)the amount of water in the blood would increase.

Answers: 2

Answer

You know the right answer?

The information contained within a gene is not directly copied into which of the following chemical...

Questions