What is the dna compliment to the given strand tacgtatgccgtatgggcatt

In biology, specifically in terms of genetics and DNA, complementary means that the polynucleotide strand paired with the second polynucleotide strand has a nitrogenous base sequence that is the reverse complement, or the pair, of the other strand.

i guess because there isn't enough love going around. < 3

the answer to the blank provided is “an autosomal gene that is required for the expression of genes on the x chromosome”.

testis-determining factor, abbreviated as td, which is more popularly known as sex-determining region y or sry protein, is a dna-binding protein or  gene-regulatory protein/transcription factor, encoded by the  sry gene. it is the gene responsible for the initiation of male gender determination in humans.