![subject](/tpl/images/cats/biologiya.png)
Biology, 02.07.2019 01:00 Trucofer8159
Generally, how do forest disturbances, competition, and other changes affect biodiversity? in turn, how does biodiversity affect forest recovery from disturbances and changes?
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:10
Scenario #2 in 2001, a population of 2,500 poison dart frogs lived in the amazon rain forest. due to increased deforestation, the population dwindled to 25 frogs in 2019. new government regulations were enacted in 2022, successfully putting an end to the deforestation of the amazon rain forest. once deforestation was stopped, the poison dart frog population was able to recover. by 2050, the population reached 8,000 frogs, of that population, 20 are homozygous recessive for being spotted (ss genotype). q2- ? q- p- p2- 2pq-
Answers: 2
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:10
Explain the cellular functions that occur when antibiotics attack a bacteria cell. a. antibiotics target the cell wall, cell membrane, and the processes of protein and nucleic acids production in bacteria to rupture the cell. b. antibiotics create dormant resistant endospores to preserve the genetic material and rupture the cell. c. antibiotics target the cell wall and form a bridge-like connection to form conjugation. d. antibiotics use binary fission to grow twice its size, replications its dna, and split into two cells.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Generally, how do forest disturbances, competition, and other changes affect biodiversity? in turn,...
Questions
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
History, 12.06.2020 01:57
![question](/tpl/images/cats/mat.png)
Mathematics, 12.06.2020 01:57
![question](/tpl/images/cats/mat.png)
Mathematics, 12.06.2020 01:57
![question](/tpl/images/cats/en.png)
English, 12.06.2020 01:57
![question](/tpl/images/cats/mat.png)
Mathematics, 12.06.2020 01:57
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 12.06.2020 01:57
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.06.2020 01:57
![question](/tpl/images/cats/mat.png)
Mathematics, 12.06.2020 01:57
![question](/tpl/images/cats/mat.png)
Mathematics, 12.06.2020 01:57
![question](/tpl/images/cats/mat.png)
Mathematics, 12.06.2020 01:57