Answers: 1
Biology, 21.06.2019 18:00
Simulating adaptations in a species in this activity, you will discuss in detail the adaptations in a species of rain forest plants. you will build a simulation that explains the changes in the traits of the plant population over 10 years. you will also establish a scientific explanation to justify the changes in the traits of the population, * time to complete: 1-2 hours part a an organism's adaptations are specific to its native environment. an organism that lives in a coniferous forest will have different adaptations compared to an animal that lives in a tropical rain forest. the following graphs show the temperature and precipitation throughout the year for two different forests: a coniferous forest in canada, and a tropical rain forest in belize. evaluate the graphs, and then explain why plants from these two ecosystems will have different adaptations. in your answer, explain the survival challenges that plants face in these two environments.
Answers: 2
Biology, 22.06.2019 10:30
Which is a function of vascular tissue? a. to perform photosynthesis b. to transport water and nutrients c. to absorb minerals and sugar d. to interact with soil fungi
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Quincy has type b blood. which allele combinations could she possibly have? check all that apply....
Mathematics, 05.06.2021 01:40
Mathematics, 05.06.2021 01:40
Mathematics, 05.06.2021 01:40
Mathematics, 05.06.2021 01:40
Engineering, 05.06.2021 01:40
SAT, 05.06.2021 01:40
History, 05.06.2021 01:40
Mathematics, 05.06.2021 01:50
English, 05.06.2021 01:50