5' atgcccgggtgtcgtagttga3' complete the complementary sequence for the template strand

If bacteria are much too small to see, what is one reason why can we see colonies in the petri dishes that have plenty of food to eat after only a few days?

Select three sports that require participants to be highly fit before the beginning a: snowboarding b: skydiving c: rock climbing d: bungee jumping e: free diving f: hiking

Which statement best describes a typical difference that could be found between the "analysis" and "conclusion" sections of a lab report? a) only the "conclusion" describes errors that occurred during the experiment, and only the "analysis" section suggests further research.b) only the "analysis" section includes specific data comparisons, and only the "conclusion" section suggests further research.c) only the "analysis" section discusses whether the original hypothesis was supported, and both sections include graphs of data.d) only the "conclusion section discusses whether the original hypothesis was supported, and both sections suggest further research.(the answer is b i just took the test)