Tell me a little about prokaryotes and eukaryotes. what do these types of cells have in common? how are they different? four sentences pls and hurry too

Predict the results of a two base insertion or deletion in a strand of dna that codes for a protien, how does this differ from a three base insertion or deletion?

Diego conducted an experiment to find out what kind of ball bounces the highest when dropped from a five-foot platform. he used a golf ball, a tennis ball, and a soccer ball. he dropped each ball from the balcony once. diego recorded his observations after each drop. what can diego do to best improve the reliability of his results? a) drop each ball from the platform three more times b) record his observations in more than one unit c) write at least two scientific questions after the experiment is complete d) share his results with other people who have done similar experiments you for the !

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?