![subject](/tpl/images/cats/biologiya.png)
Biology, 10.07.2019 06:00 laylahedwards
13. what is another name for rod shaped bacteria? a. bacilli b. cocci c. spirilla
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 01:00
Plz genetic engineering can be applied to many fields including medicine and agriculture. which of the following is a medical application of genetic engineering? a. giving crop plants recombinant dna so that they would be resistant to herbicides. b. examining a persons pedigree to determine whether they can carry a gene for a genetic disease. c. analyzing a persons dna to see how closely they are related to another person. d. certain genes into bacteria so that they will produce a needed medicine.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:50
Below are the three main organs that make up the plant body. what is the main function of the structure that is identified as b in the picture above? it anchors the plant.it produces food.it absorbs nutrients.it supports the plan
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00
Pls ! in your opinion, what are the limiting factors that might affect the growth or diversity of our ecosystem? respond to this question in claim, evidence, reasoning format. 1. make your claim (i are the limiting factors that might affect the growth or diversity of our 2. follow the claim with 3 pieces of evidence. evidence may be taken from the reading, the videos, previous lessons, or googled answers. site sources, too. 3. use reasoning to explain why you chose your evidence.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
13. what is another name for rod shaped bacteria? a. bacilli b. cocci c. spirilla...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.04.2020 17:23
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 22.04.2020 17:23
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.04.2020 17:23
![question](/tpl/images/cats/mat.png)
Mathematics, 22.04.2020 17:23
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.04.2020 17:23
![question](/tpl/images/cats/mat.png)