subject
Biology, 11.07.2019 15:00 JANA279

Aclient with esophageal cancer is to receive total parenteral nutrition. a right subclavian catheter is inserted. what is the primary reason total parenteral nutrition is infused through a central line rather than a peripheral line

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 09:30
Archaebacteria use for movement. celia flagella pili cell walls
Answers: 2
question
Biology, 22.06.2019 10:00
In what part of the body does the most muscle activity happen?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:10
People with one sickle cell allele are not likely to get malaria. what is this an example of?
Answers: 1
You know the right answer?
Aclient with esophageal cancer is to receive total parenteral nutrition. a right subclavian catheter...
Questions
question
Social Studies, 21.07.2019 22:20
Questions on the website: 13722367