Biology, 13.07.2019 16:00 DragonWarrior203

"the "brer fox" and "brer rabbit" folktales illustrate how"

Answers: 1

Show answers

Another question on Biology

Biology, 22.06.2019 04:00

1) strawberry plants typically reproduce by making runners, which are miniature versions of themselves, that grow off of the roots and stems of the parent. this type of vegetative reproduction is known as a) pollination. b) fragmentation. c) binary fission. d) vegetative propogation.

Answers: 2

Answer

Biology, 22.06.2019 09:10

Explain the cellular functions that occur when antibiotics attack a bacteria cell. a. antibiotics target the cell wall, cell membrane, and the processes of protein and nucleic acids production in bacteria to rupture the cell. b. antibiotics create dormant resistant endospores to preserve the genetic material and rupture the cell. c. antibiotics target the cell wall and form a bridge-like connection to form conjugation. d. antibiotics use binary fission to grow twice its size, replications its dna, and split into two cells.

Answers: 2

Answer

Biology, 22.06.2019 11:00

Which of these is true of the cytoplasm of an unfertilized egg? a. it is an unevenly distributed mixture of mrna, proteins, organelles, and other substances. b. it does not contain substances that are important in directing development. c. these substances are supplied by the sperm. d. it does not contain substances that are important in directing development. e. development is directed solely by the surrounding cells. f. it is a homogeneous mixture of mrna, proteins, organelles, and other substances. g. it does not contain substances that are important in directing development. h. these substances are produced by the dna of the fertilized zygote.

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

"the "brer fox" and "brer rabbit" folktales illustrate how"...

Questions