subject
Biology, 21.08.2019 21:00 sickomode2048

Is a limiting factor in many ecosystems. a) air b) sunlight c) shelter d) water

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 23:50
Which statement about the immune system is false? a. lymphocytes reduce inflammation, b. b cells remember specific pathogens. c. most white blood cells kill bacteria d. white blood cells are made in lymph nodes.
Answers: 1
question
Biology, 22.06.2019 00:30
What was the land like over 500 million years ago? what was under the sea?
Answers: 1
question
Biology, 22.06.2019 01:10
Determine if the following statement is true or false. if true, choose true. if false, choose the rewording that is true. according to the law of independent assortment, alleles for each gene are inherited together so that they always stay together. according to the law of independent assortment, offspring express a combination of their parents' traits. according to the law of independent assortment, alleles for a characteristic split during meiosis and combine during fertilization. true according to the law of independent assortment, alleles for each gene are inherited independently so that no two alleles stay together.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Is a limiting factor in many ecosystems. a) air b) sunlight c) shelter d) water...
Questions
question
Biology, 14.04.2020 22:30
question
English, 14.04.2020 22:30
Questions on the website: 13722367