List the nitrogen bases that would form the complementary strand: ttctaccctacatagactcat

an organism's phenotype is the  form of a trait  that it  displays. for  flowercolor, a pea  plant  can  display  a phenotype of purple or white flowers. an organism's  genotype  is the alleles of a gene it contains. based on his data, mendel concluded that a phenotype can be  determined  by more than one  genotype.

in the year 2850, humans successfully colonized mars. the martian modules that were constructed could hold only a small population of people. it is now a century later, and the population on mars has grown to 600 people. of the current mars population, 45 people express the recessive phenotype for phenylketon- uria (pku) syndrome (pp genotype).

explanation: