Answers: 1
Biology, 22.06.2019 00:00
If the coding part of an mrna molecule is 1800 nucleotides (bases) in length, this molecule will contain codons and code for a polypeptide that is amino acids long.
Answers: 3
Biology, 22.06.2019 10:00
The image shows the evolution of a species of fish. a few fish from a population developed different social behaviors and evolved into different species. two fish according to the image, the fish underwent . the new species of fish had mating seasons that were different from that of the original fish. because of the differences in mating seasons, the fish underwent reproductive isolation. this mode of isolation would be .
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
In the pea plant, the allele for green pod color (g) dominates the allele for yellow pod color (g)....
Mathematics, 19.08.2020 20:01
Mathematics, 19.08.2020 20:01
Mathematics, 19.08.2020 20:01
Mathematics, 19.08.2020 20:01
Mathematics, 19.08.2020 20:01
Mathematics, 19.08.2020 20:01
Business, 19.08.2020 20:01
Mathematics, 19.08.2020 20:01