Answers: 1
Biology, 21.06.2019 19:40
Populations of blue-winged warblers, a type of bird, migrate south in the winter and return to canadian breeding grounds in the spring. as global temperatures have increased due to climate change, spring has started arriving in the warbler's breeding grounds earlier in the year, before the warblers return. warblers now arrive at their breeding grounds too late to select ideal nesting sites and to feed on important early-spring food sources how are populations of blue-winged warblers most likely to be affected by the earlier arrival of spring? o a. populations will go extinct since the warblers will stop migrating to breeding grounds. b. populations will be unaffected since most species can quickly adapt to effects of climate change. c. populations will increase since warmer temperatures are generally beneficial to survival, d. populations will decline since individuals will be less likely to successfully reproduce, reset next
Answers: 1
Biology, 22.06.2019 08:00
Immature bone cells, or osteoblasts, manufacture a protein called osteoid as well as several hormones. because of this, we would expect osteoblasts to contain numerous a) nuclei. b) ribosomes. c) lysosomes. d) golgi bodies.
Answers: 1
Biology, 22.06.2019 09:30
Drag each description to the correct location on the image. not all descriptions will be used. describe the parts of a comet. the frozen part of the comet the atmosphere of gases and dust formed when the nucleus vaporizes tail made of small, solid dust particles tail made of ions that appears to point away from the comet's orbit
Answers: 1
Pl find mrna and a. a sequnce to this sickle cell hemoglobin dna- cacgtggactgaggacacctc sickle cel...
Mathematics, 17.10.2021 14:00
Mathematics, 17.10.2021 14:00
History, 17.10.2021 14:00
Mathematics, 17.10.2021 14:00
Mathematics, 17.10.2021 14:00
Mathematics, 17.10.2021 14:00
Arts, 17.10.2021 14:00
English, 17.10.2021 14:00
Mathematics, 17.10.2021 14:00
Spanish, 17.10.2021 14:00
Mathematics, 17.10.2021 14:00
Mathematics, 17.10.2021 14:00
Mathematics, 17.10.2021 14:00